Vida de un adolescente (varias parejas)

Tema en 'Fanfics Abandonados de Naruto' iniciado por DawnPanIno, 13 Octubre 2009.

Cargando...
Estado del tema:
No se permiten más respuestas.
  1.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    2438
    Re: Vida de un adolescente (varias parejas)

    *********sigan comentando akii la contiii************** quiero preguntarle a mis pocos lectores que me dejen en un comentario, que si la acabo en la fiesta de halloween o la alargo un poco más??? dejen comentario y su propuesta....*********



    Bueno Lee cerró sesión – dijo Neji - ¿Qué me querías decir?
    Nada… oye ¿te gusta alguna niña de la escuela? – preguntó Tenten
    ¿Y esa pregunta? – dijo Neji algo sonrojado por la pregunta – ahora que lo dices si me gusta alguien
    Puedo… ¿puedo saber quien es? – dijo Tenten
    No “no puedo decirle que es ella, no estoy preparado aún” – dijo y pensó Neji
    ¿te gusta Sakura? – preguntó Tenten
    “¿por que preguntó eso?, ¿parece que a mi me gusta Sakura?, que tal si descubre que me gusta ella y me deja de hablar” si me gusta Sakura, ¿Por qué lo preguntas? – dijo Neji
    Solo curiosidad, fue un lindo gesto que la invitaras al baile sabiendo que no tiene pareja, así tendrás una pequeña oportunidad para conquistarla – dijo Tenten en un tono triste y apagado pero con una sonrisa falsa en sus labios – gracias por confiar en mi y decirme
    Eres mi mejor amiga te tengo mucha confianza y creo que me conoces demasiado, como para no haberte dado cuenta de quien me gusta – dijo Neji - “Tenten se creyó lo de Sakura, espero que no lo tome mal y no se lo diga, no quiero enredar las cosas ni confundirla, la quiero, pero temó lastimarla y que me rechace y vaya con Lee”
    Bueno en ese caso me voy nos vemos el lunes en la escuela, adiós – dijo Tenten dándole un beso en la mejilla a Neji
    Hasta el lunes, ¿te acompaño a la puerta o vas a pasar a ver a Hinata?
    Voy con Hinata hasta luego – se despidió Tenten mientras salía de la habitación del chico Hyuga y se dirigía al cuarto de su amiga, tocó la puerta y le abrieron
    Chicas todavía están aquí, que sorpresa – dijo Tenten
    Si es que queríamos irnos cuando regresarás – dijo Sakura
    Pero ¿Cómo sabían que regresaría? – preguntó Tenten
    Pues mejor cuéntanos como se te declaró Neji, vimos como cuando saliste corriendo fue detrás de ti tan romántico estoy segura que te fue a decir algo aunque cuando regresó estaba algo triste – dijo Temari
    ¿triste? bueno no importa, me acaba de decir quien le gusta y esa chica tiene suerte – dijo Tenten desilusionada – y ¿Dónde esta Hinata?
    Je ,je Naruto se la llevó a comer ramen y queremos ver que le dice, otra razón más para esperar – dijo Sakura emocionada por su amiga
    ¿enserio? – dijo Tenten
    Si claro, cuando Hinata despertó de su desmayo Naruto la invitó para que “se sintiera mejor”, ya ver que piensa que una buena sopa lo resuelve todo, pero aún así sigue siendo una cita – dijo Temari
    Mientras tanto en el puesto de sopas llamado Ichiraku:
    Hinata ¿te gusta tu Ramen?, estas muy roja, o es acaso ¿que te quemaste la boca?- preguntó Naruto
    No…no, no es eso…solo que comes muy lindo – dijo Hinata sonrojándose
    No, tu eres muy linda por invitarme a comer Ramen – dijo Naruto sonriendo
    ¡Naruto! – dijo el dueño de la tienda – no es posible que hagas a tu novia pagar tu comida
    Eso es cierto ¿que son esos modales?, pobre de tu novia Naruto –dijo Ayame la hija del dueño del puesto, mirando a Hinata
    Yo… yo no soy la novia de Naruto – dijo Hinata
    A lo siento por confundirte tan feo, ser la novia de Naruto debería ser una tortura, ¿como soportar a un chico como él?– dijo el dueño de la tienda
    Oye viejo no le hables así a Hinata, además yo soy muy guapo y el más popular del salón – dijo gritando Naruto
    Eh… Naruto el más popular del salón es Sasuke – dijo Hinata corrigiendo a Naruto
    Bueno el segundo más popular – dijo el rubio
    Te estas equivocando otra vez, el segundo más popular es mi primo Neji, después va Gaara, Sai, Kiba, Shikamaru y luego tú – corrigió Hinata
    ¿Estoy tan atrás? Ahora jamás conquistare a ninguna chica- dijo Naruto
    Yo no estaría tan segura, alguien correcto vendrá Naruto pero deberías de mirar bien a las personas que te rodean y quienes se sonrojan cuando pronuncian tú nombre ¿no es cierto Hinata? – preguntó Ayame dándole una indirecta
    Si…si claro – respondió Hinata
    Lo hare Ayame tienes razón Sakura no es la única chava del mundo y lograré ser el más popular del salón – dijo Naruto con posee de “niño bien”
    …- Hinata no dijo nada solo sonrió
    Así se habla Naruto y como vienes acompañado de tu no…vi…amiga para no verme tan mal les regalaré el ramen que están comiendo y Hinata ¿te llamas así no? – dijo el dueño de la tienda mirando a Hinata
    Si, señor –respondió ella
    Espero que vuelva a verlos pronto por aquí comiendo ramen – dijo el señor
    Si claro este es mi local favorito – dijo Naruto con una sonrisa
    Si Naruto la próxima vez que vengas espero que ya tengas novia y que tú pagues las sopas– dijo el Señor riéndose
    No es gracioso, yo vengo a comer aquí todos los días para mañana no podré conseguir una novia – dijo Naruto algo enojado
    Bueno invita a Hinata y tu pagas – dijo Ayame
    Esta bien, bueno ya terminamos ¿verdad Hinata? – dijo Naruto
    S…si, muchas gracias estuvo muy rico – dijo Hinata levantándose de su silla y retirándose
    Vuelvan pronto – dijeron el dueño y Ayame despidiéndose de Hinata y Naruto que abandonaron el puesto para ir a la casa de los Hyuga
    Oye Hinata – decía Naruto mientras pasaban por un parque que quedaba camino a la casa – ¿enserio soy tan impopular?
    Naruto, tal vez me equivoqué, Sai y Gaara no son de nuestro salón y ellos no cuentan, Shikamaru solo porque es inteligente pero no es muy guapo, ahora tú eres más lindo que mi primo, entonces quedas en segundo lugar después de Sasuke
    ¿Tu crees eso?- dijo Naruto tomando de la mano a Hinata
    Si, claro eres muy lindo – dijo Hinata un poco colorada
    Estas muy roja Hinata, eso me recuerda que tengo que buscar una chica que se sonroje con solo verme – dijo Naruto
    “espero que Naruto no se dé cuenta de que me gusta, no puedo controlarme no se porque estoy tan roja” – pensó Hinata
    Oye Hina ¿a ti te gusta alguien del salón? – preguntó Naruto
    Yo… etto… eh… si… - dijo Tartamudeando Hinata
    ¿Quién es? – dijo muy feliz Naruto - ¿es alguien del salón?
    Es alguien… del salón, pero no quiero decirte quien es, porque luego le vas a decir y me rechazará, además el esta enamorado de otra chica – dijo Hinata
    Que tonto al no darse cuenta de que tiene una niña tan linda enamorada de el a de ser un estúpido – dijo Naruto
    No te digas… perdón no le digas tan feo – dijo Hinata – él no es un tonto
    Bueno el amor esta en el ojo del que mira – dijo Naruto
    Si eso es cierto, mira que lindo collar el de ese aparador – dijo Hinata mientras pasaban por la ventana de una tienda y veían un collar con un cristal azul (igual al que le dio Tsunade a Naruto en la serie) - déjame preguntar cuanto cuesta ¿si?
    Si - dijo Naruto – mientras veía como Hinata entraba a la tienda
    Ya adentro de la tienda Hinata preguntó el precio de aquel collar y le pareció muy razonable entonces lo compró y pidió que lo envolvieran, cuando salió:
    ¿Lo compraste? – preguntó Naruto
    Si es un regalo de cumpleaños – dijo Hinata
    De seguro es para el chico del que me hablaste – dijo Naruto cruzando los brazos como un niño pequeño y enojado
    Ja,ja no estés celoso, mejor sigamos caminando, mi casa no esta tan lejos, ven hay que correr – dijo Hinata
    Esta bien, pero te voy a ganar – dijo Naruto mientras tomaba la mano de Hinata y corrían juntos
    En ese momento empezó a llover, el agua cubría esos dos cuerpos que en el atardecer se movían como dos hojas bailando en el viento, tomados de la mano un suave rose de piel y sus dedos entrelazados un momento de 10m metros se convirtió en una eternidad llena de tierno amor entre dos personas
    Listo ya llegamos Hinata- dijo Naruto
    Je, je estoy empapada por la lluvia, gracias Naruto este a sido un día muy divertido y toma – dijo Hinata entregándole el regalo que había comprado en la tienda
    Es el collar que compraste, ¿me lo regalas? – dijo Naruto
    Si, es para ti hace tres días fue tu cumpleaños ¿no? – dijo Hinata sonriendo
    Si, gracias por acordarte, eres una gran persona y buena amiga – dijo Naruto mientras le daba un abrazo a Hinata y le susurraba al oído: siempre pensé que eras algo rara y siempre tartamudeabas pero me equivoque, espero que ese tonto que te gusta se de cuenta que de veraz vale la pena una niña tan dulce como tú.
    En ese momento las luces de un auto se estacionaron al lado de la casa y solo se oyó una voz diciendo: Hinata Hyuga, haciendo que los dos jóvenes se separaran de aquel hermoso abrazo
    ************adiven quein sera esa voz***jeje proximo capi muy pronto*************
     
  2.  
    sakurakushku

    sakurakushku Entusiasta

    Acuario
    Miembro desde:
    18 Abril 2009
    Mensajes:
    87
    Pluma de
    Escritor
    Re: Vida de un adolescente (varias parejas)

    :O de qen sera la voz misteriosa qe interrumpio el ermoso abrazo ¬¬. i espero qe el tonto de neji le confiese a tenten lo qe siente por eia i qe el tonto de naruto se de cuenta de la leenda niña qe tiene a su lado. pobre tenten :( qe se creyo eso de qe a naji le gustaba sakura, qe tonta bueno espero la conti ! siguelo ! i perdon por averme perdido tantas contis, esq andava de vacaciones :P bueno saludos chau!

    ATTE. Katee!
     
  3.  
    ATANIH

    ATANIH Entusiasta

    Géminis
    Miembro desde:
    12 Mayo 2009
    Mensajes:
    132
    Pluma de
    Re: Vida de un adolescente (varias parejas)

    si opino lo mismo que jeen que tu fic termine despues de la fiesta claro siempre y cuando tengas tus ideas bien claras que e que asi es ya que eres muy buena escribiendo jejeje y creo que ya me doy una idea de quien es la voz pero no lo dire para no quitarle emocion a tu maravilloso fic jejejej

    y guau me gusto la ecena en donde le da el collar que lido y cuando la toma de la mano para correr juntos de verdad me encanta tu forma de narrar creo que siempre te lo digo y creme espero que a este fic le falte un poco para terminar que sean unos capitulos mas despues de la fiesta de halloween claro siempre y cuando tu quieres hacerlo asi

    y que malo es neji cono se le ocurre decirle eso a TEnTEn, ya que se decida de una buena ves, creme nunca pense que fuera tan miedoso jejeje

    esa personalidad que le pusiste me agrada un poco jeje e

    y yo creo que no podria lastimar a TenTen si le dice lo que siente ya que ella lo ama con todo el corazón

    sayonara

    tomodashi
     
  4.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    2165
    Re: Vida de un adolescente (varias parejas)

    En ese momento las luces de un auto se estacionaron al lado de la casa y solo se oyó una voz diciendo: Hinata Hyuga, haciendo que los dos jóvenes se separaran de aquel hermoso abrazo
    Ah, Hola papá – dijo La joven, al ver que su padre acababa de llegar y los había visto abrazados – el es mi amigo Naruto – dijo Hinata presentando a su acompañante
    Hola señor- dijo Naruto extendiendo la mano en muestra de saludo
    Buenas noches – dijo el señor correspondiendo con cortesía
    Naruto, él es mi padre, Hiashi Hyuga – dijo Hinata presentándolos
    Bueno en ese caso yo ya me voy, nos vemos el lunes en la escuela, adiós – dijo Naruto dándole un beso en la mejilla a Hinata lo cual hizo que la Hyuga se sonrojara y de esto se percato el rubio hiperactivo – “Hinata se sonrojo, será ¿Por qué le gustó”, yo gustarle a Hinata, no creo y ¿si ese chico tonto que no se da cuenta que Hinata esta tras él soy yo?, no mejor no me creo falsas ilusiones” –pensaba Naruto mientras caminaba en dirección a su casa
    Ahora explícame señorita ¿Qué hacías con Naruto? – dijo Hiashi al entrar a su casa
    Él me invitó a cenar ramen y yo acepté – dijo Hinata
    Hinata tu todavía estas muy pequeña para que salgas a solas con un jovencito y no me gusta verte tan de noche sola por la calle – dijo Hiashi
    Pero ni siquiera es de noche son las seis quince la de tarde y no estaba sola iba con Naruto – dijo Hinata en defensa
    No me importa, ahora la hora de llegada a ésta casa será a las seis en punto de la tarde o serán castigados y eso va para Neji y Hanabi también
    En ese momento Hanabi salió de la cocina donde estaba comiendo y Neji al oír la voz de su tío salió de su habitación y les dijo a las amigas de Hinata que ni se les ocurriera bajar y se encerraran el la habitación de su prima, mientras el bajaba a la sala donde se llevaba acabo la discusión
    Buenas noches tío – saludó Neji
    Que bueno que bajas, les propondré un trato a ustedes dos – dijo señalando a Hinata y a Neji
    De… ¿de que se trata padre?- preguntó Hinata
    Su horario de llegada era a las ocho de la noche pero ahora se recortarán dos horas así que los quiero ver aquí a las seis de la tarde o que tú Neji cuides de Hinata, y si sale con algún chico tú vayas con ella, no me gusta dejarla sola y tú lo sabes te lo dije hoy en la mañana
    RECUERDO
    - Bueno Neji, dime ¿Qué necesitas? – preguntó Hiashi
    - Es que quiero consejos, como mi padre no esta aquí pensé en hablar con usted – dijo Neji
    - ¿Es de chicas, cambios de tu cuerpo o de qué? – dijo un poco nervioso
    - Supongo que es de chicas, es una chava, Tenten la amiga de Hinata la que se peina con dos pequeñas cebollitas – dijo Neji
    - Sé quien es, Amma Tenten, ¿Qué pasa con ella?- dijo Hiashi
    - Bueno, ella es mi mejor amiga y no se que pasa con ella con solo pensar en ella me pongo feliz, luego pienso en si estoy enamorado de ella y yo no puedo querer a mi mejor amiga ¡no se que hacer! – dijo Neji
    - Que complicado – dijo Hiashi – pero ¿por qué no la puedes querer?
    - Es que me rechazará, yo lo se y como me dice Shikamaru, me estoy tragando todo mi orgullo para reconocer que me gusta y el destino me la quitara de una forma muy cruel – dijo Neji
    - Ese Shikamaru tiene razón para querer a una chica se necesita tragarse todo el orgullo y la soberbia que tienes, la quieres demasiado, le deberías de decir lo que realmente sientes – dijo el padre de Hinata – tú eres un chico Responsable y honesto no como esos compañeros que tienes que piensas cualquier barbaridad por eso no dejo a Hinata que tenga novio, pero lo siento esa es otra historia
    - …- Neji sonrió – si a Hinata le gusta un Chavo mi compañero Naruto, pero el aunque es distraído es una buena persona, Naruto Uzumaki Namikaze, es Hijo del presidente de la ciudad de Konoha
    - Quisiera conocer a ese chico, y decirle unas cuantas palabra – dijo Hiashi
    - Él es un tonto nunca se fijaría en Hinata, quiere a una chava que se llama Sakura – dijo Neji
    - Eso me alegra, porque si descubro que mi hija sale con alguien, te pondría a que fueras su chaperón y la siguieras a todos lados – dijo el señor
    - Aceptaré – dijo Neji
    - Pero tú cuidar a tu prima menor, no comprendo- dijo Hiashi
    - No quiero que le diga a nadie sobre esta platica, ni a Hinata no quiero que ella se enteré y le diga a Tenten, yo le quiero decir cuando este preparado – dijo Neji con un tono muy lindo de su parte
    - ¿Tienes miedo? Preguntó Hiashi – si ¿tienes miedo de lo que puedan pensar de ti?
    - Al principio me costó mucho darme cuenta que estaba enamorado, mi orgullo no me dejaba ver lo que me rodeaba y esta estúpida soberbia que tenemos Sasuke y yo de que no queremos admitir nuestros sentimientos, yo no quiero ser un tonto o que me acusen de que no me gustan las mujeres, solo quiero decirle a Tenten lo que siento cuando este preparado y ella este dispuesta a aceptarme – dijo Neji

    Fin del recuerdo



    - Si, lo recuerdo – dijo Neji – y si Hinata esta de acuerdo la puedo acompañar
    - ¿Qué dices Hinata? – preguntó su padre
    - Pero…etto… esta bien, pero solo cuando salga con compañeros, no lo quiero cerca cuando estén mis compañeras – dijo Hinata
    - ¿y eso por qué? – dijeron los dos Hyuga
    - Etto… por razones personales, quiero tener un espacio para mi – dijo Hinata
    - En ese caso, así se queda y vayan a sus habitaciones – dijo Hiashi
    - Si – dijeron Hinata y Neji mientras se retiraban de la sala y subían al segundo piso, cuando subieron y Hinata subió a su habitación:
    - Chicas que… ¿Qué hacen aquí? – dijo Hinata
    - Esperando a que nos cuentes que paso cuando fueron a Ichiraku – dijo Temari - ¿Se te declaró?, ¿Cuándo llovía se tomaron de las manos? , ¿le compraste el regalo que le ibas a comprar de cumpleaños?, ¿se abrazaron?, ¿se besaron? ¿Qué paso Hinata? Dinos – decía Temari ansiosa
    - No… solo comimos… le compre una cadenita de cumpleaños… y cuando empezó a llover me tomó de la mano y corrimos hasta aquí, donde me abrazó y luego mi padre nos interrumpió – dijo Hinata
    - Que romántico, que suertuda eres Hinata – dijo Tenten
    - Oigan chicas y ¿a que hora nos vamos a ir?- dijo Sakura
    - Si es cierto como mi padre ya esta en la casa será difícil salir por la puerta principal- dijo Hinata
    - Pues nos salimos por la ventana – bromeó Tenten
    - Si quieren salirse por la ventana, por ésta no se puede yo por eso salgo por la ventana de mi primo, ya que en ésta habitación y en la mía no se puede salir por la ventana – dijo Hanabi
    - ¡Hanabi! ¿tú te haz escapado de la casa? – dijo Hinata
    - Si unas cuantas veces… solo hice una escalera de tela y desciendo por la ventana del cuarto de Neji – dijo Hanabi

    - Yo solo pensé que era una broma – dijo Tenten

    - No, hay que bajar por la ventana – dijo Temari

    - Yo iré por la escalera – dijo Hanabi mientras salía de la habitación, iba a su cuarto y traía la “escalera”, cuando la llevó tocaron la puerta de Neji

    - ¿Qué pasa? – preguntó Neji - ¿Bajaran por mi ventana?

    - ¿Cómo lo supiste? Eres un genio – preguntó Hanabi

    - Bueno solo salgan rápido – dijo Neji mientras abría su ventana

    Las chicas entraron a la habitación y Hanabi deslizó la escalinata de tela, Temari fue la primera que bajo, mientras Sakura le lanzaba sus cosas, Tenten estaba apunto de bajar cuando oyó algo que la dejo muy triste:
    ****************************************************************************
    muchas grazias a todos los lectores, mi fanfic ya e una de las más leidas en el foro y tambien la voy a alargar, les dejo un capitulo porque la proxima semana no voy a poner y esta fayando mi c0ompu porke postea doble la historia bueno me voii biiie
    Chaonara
     
  5.  
    jenn uchiha

    jenn uchiha Entusiasta

    Capricornio
    Miembro desde:
    3 Noviembre 2009
    Mensajes:
    162
    Re: Vida de un adolescente (varias parejas)

    hola¡¡¡...
    haii te salio muy linda la platica de Neji y su tio ;)
    y que mal que el papa de hinata no quiera que tenga novio :(
    pero naruto es muy linda y se empieza a dar cuenta de que
    quiere a hinata xD sisiisisisisisii...muy bien :)
    bueno que fue lo que escucho Tenten para ponerla triste ´¿¿??
    emm ya quiero ver la fiesta ,...haahahhaha..
    bueno baeeeaaii
     
  6.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    617
    Re: Vida de un adolescente (varias parejas)

    Las chicas entraron a la habitación y Hanabi deslizó la escalinata de tela, Temari fue la primera que bajo, mientras Sakura le lanzaba sus cosas, Tenten estaba apunto de bajar cuando oyó algo que la dejo muy triste:
    - Sakura necesito hablar contigo ¿podemos hablar? – dijo Neji
    - Si – dijo Sakura
    - Vamos afuera
    Afuera de la habitación de Neji:
    - ¿Cómo te lo explico? – preguntó Neji – a mi me gusta Tenten
    - Ya lo sabía dime algo que no sepa – dijo Sakura
    - Si quieres saber algo que no sabias bueno, Sasuke te qui… no eso no lo puedo decir se lo prometí, bueno el chiste es que… Tenten me preguntó que si me gustaba una chica del salón y le dije que si – dijo Neji
    - ¿Te le declaraste? - preguntó ilusa Sakura
    - No, cometí una tontería, sin ofender- dijo Neji
    - ¿Qué le dijiste? – cuestionó Sakura
    - Que me gustabas – dijo Neji
    - ¿¡que!? – dijo Sakura
    - Si, y quiero aclarar esta situación, fue una tontería ya lo se, y no quiero que le digas a Tenten que me gusta si te manda una indirecta o dice algo parecido ¿me entiendes? – preguntó Neji
    - Si cuenta conmigo – dijo Sakura – ahora ¿Qué ibas a decir de Sasuke?
    - Nada, es un secreto que me dijo, el opina lo mismo que yo, hasta que se sienta preparado hablara contigo y yo con Tenten – dijo Neji
    - Ok, bueno me voy, tengo que bajar – dijo Sakura – mientras entraba a la recamara, lanzaba sus cosas para abajo y descendía por la ventana
    Abajo
    - Adiós, nos vemos el Lunes – se despidieron las tres chicas al mismo tiempo
    - ¿Por qué te tardaste tanto Sakura? – preguntó Temari
    - ¿Qué te dijo Neji? – preguntó Tenten celosa
    - ¿Por qué eres tan celosa? – preguntó Sakura – solo platicamos
    - Esta bien – dijo Tenten mientras se iba a su casa – hasta el lunes, bye
    - Si adiós – respondieron las otras dos chicas
    Ellas se fueron a sus respectivas casas, todas caminaban muy pensantes en especial Tenten quien se preguntaba ¿Qué le habría dicho Neji a Sakura? O si ya serían novios.
    **************los post serán más cortos pero tratare de ponerlos diario***********
     
    • Me gusta Me gusta x 1
  7.  
    Solsti

    Solsti Usuario común

    Cáncer
    Miembro desde:
    22 Octubre 2008
    Mensajes:
    297
    Pluma de
    Escritora
    Re: Vida de un adolescente (varias parejas)

    uhhhhh... que lindo post diarios!!! wiiii
    me encantaaaa... que mal lo que le haces a la pobre de TenTen...
    bueno, hoy me lei dos o tres contis que me faltaban y ya estoy al dia de nuevo!!!!
    no note errores y soy primerrrraaaaaaaaaaaa!!! :D

    espero que te pases por mis fics y comentes a ver que tal jijiji
    espero que te gusten y conti nues la historia que esta muy pero muy buena! :)
     
  8.  
    Hyuuga

    Hyuuga Beta-Reader

    Libra
    Miembro desde:
    25 Marzo 2009
    Mensajes:
    354
    Pluma de
    Escritor
    Re: Vida de un adolescente (varias parejas)

    Holaaaa ooo me haaa gustaddo muxoo
    tu historiia oo
    realmente esta muy buena, me has echo reír, enojarme, llorar, saltar de la emocion y muxas cosa más jaja x3
    me dehhassteee supper intrigada con lo de TenTen!!! ooo amoo el NejiTen!!! ok ia me calmo
    jeje buenooo te digo que esta super tu historia solo te recomiendo que pongas más narración, los fanfic deben
    tener mucha narración no solo diálogo, bueno esperooo anciosiiiiismaa la conti
    n__n
     
  9.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    1095
    Re: Vida de un adolescente (varias parejas)

    *************trayendo conti******************


    Ellas se fueron a sus respectivas casas, todas caminaban muy pensantes en especial Tenten quien se preguntaba ¿Qué le habría dicho Neji a Sakura? O si ya serían novios.
    El domingo pasó muy rápido y llegó el lunes cuando todos los jóvenes fueron a la escuela
    - ¿Cómo estuvo su fin de semana – saludó la directora Tsunade
    - …- el salón se quedo callado
    - Bueno chicos, va a ver muchos cambios por aquí, el primer cambio será que el grupo “a” y el “b” se unirán para formar un nuevo grupo y como el “b” es el salón más grande y con más alumnos se disuelve el “a” así que aquí están sus nuevos y conocidos compañeros y la otra sorpresa será que tenemos estudiantes de intercambio – Dijo Tsunade señalando a seis chicos
    - Mi nombre Sakon – dijo un chico de cabello lila y de ojos cafés
    - Mi nombre es Ukon y soy el gemelo de Sakon – dijo un chico igual a otro
    - Mi nombre es Kimimaru es un placer – dijo un chico de cabello blanco con ojos de color verde y unas ojeritas de color rojo
    - Mi nombre es kidomaru – dijo un chico moreno de pelo café y ojos del mismo color (N/A tenia dos brazos)
    - Mi nombre ese Tayuya y obtengo lo que quiero no se metan conmigo – decía una joven de ojos cafés y pelo rojo
    - Y yo soy Kin mucho gusto – dijo una morena de pelo negro y largo
    - Bueno sean buenos con sus nuevos compañeros que estarán aquí solo una semana – dijo la directora Tsunade antes de que oyera un “que problemático” - el que dijo eso fuiste tú ¿no Nara?
    - Si fui yo y es muy problemático – contestó Shikamaru
    - Bueno a ver tu les mostraras toda la escuela a tus compañeros nuevos – dijo Tsunade
    - ¡que! Pero es mucho – reclamo Nara
    - Bueno que te ayude el joven Inuzuka, la señorita Haruno, Amma, Matsuri y la jovencita Hyuga y rápido – dio la orden Tsunade
    Los doce chicos salieron del salón rápido
    - Bueno, mi nombre es Shikamaru Nara, ellas son Matsuri, Sakura, Tenten, Hinata y el es Kiba
    - Hola – saludaron los otros seis chicos
    - Bueno, que les parece si cada uno se va con uno de ustedes – dijo Tayuya señalando a sus compañeros
    - Esta bien, Hinata ve con Kimimaru, Matsuri Ve con Ukon, Sakura muéstrale la escuela a Sakon, Kiba ve con Kin, Tenten vas con Tayuya y yo con Kidomaru – Dijo Shikamaru
    - No, yo quiero ir con la linda niña de los moñitos – dijo Kidomaru mirando a Tenten
    - Esta bien – Dijo Tenten, mientras todos se distribuían por la escuela enseñándole la institución a sus nuevos camaradas

    Con Sakon y Sakura

    - Que linda escuela- dijo Sakon
    - Si es muy linda, tiene patios y zonas verdes muy amplias, su nivel académico es muy bueno, los profesores son muy corteses y los alumnos son respetuosos es una linda escuela – dijo Sakura
    - Y tiene chicas muy lindas- dijo Sakon viendo a la pelo rosado
    - …- Sakura se sonrojo mucho por el comentario del chico
    - Oye Sakura ¿tienes novio? – preguntó Sakon
    - No pero me gusta un chico se llama Sasuke es perfecto – dijo Sakura mientras miraba el suelo con un tono carmesí en sus mejillas
    - Ok – dijo Sakon mientras caminaba con Sakura al lado

    Con Matsuri y Ukon

    - Ya me cansé de caminar – dijo Ukon - ¿Qué no termina esta escuela jamás?
    - Claro, pero todavía falta mucho – dijo Matsuri con una sonrisa
    - ¿Por qué quisiste mostrarme la escuela? –preguntó Ukon
    - Me gusta cooperar y es un lindo gesto ayudar a los compañeros nuevos- dijo Matsuri sonriendo
    - Ok, ¿Y tu tienes novio Matsuri? – dijo Ukon
    - Si , se llama Gaara es un amor de persona aunque todos piensen que es una mala persona – dijo Matsuri
    - Bueno hay que terminar de recorrer la escuela – dijo Ukon mientras caminaba


    ***********************************************
    sorry pero asta el miercoles la conti
    tratare de ponerle más narracion =)
     
    • Me gusta Me gusta x 1
  10.  
    Solsti

    Solsti Usuario común

    Cáncer
    Miembro desde:
    22 Octubre 2008
    Mensajes:
    297
    Pluma de
    Escritora
    Re: Vida de un adolescente (varias parejas)

    que lindo y no te preocupes por la conti, solo no la pongas hasta dentro de 3 semanas xD
    Y me parece que a Kidomaru le gusta TenTen jajaja :)
    esta muy buena y espero que si le pongas un poco mas de narracion y las hagas un poco mas largas ya que estan un poco cortitas...
    los chicos tienen competensia.. uhhh!!!

    :chauchis: y PRIMERAAAAA!!!
     
  11.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    2427
    Re: Vida de un adolescente (varias parejas)

    ********para no decepcionar a mis fans, la conti*************************
    falta lo mejor, se los dejo en suspenso ***********************************************************************

    Kiba y Kin

    - Oye Kiba, yo no soy mujer de rodeo – dijo Kin
    - Y ¿eso a que viene? – preguntó Kiba
    - Yo la verdad no soy como los demás nuevos del salón y no vine aquí a estudiar tengo otras intenciones – dijo Kin
    - ¿como cuales? – preguntó Kiba
    - ¿Quieres descubrirlas? – dijo Kin
    - Si ¿Por qué no? – dijo Kiba, en ese momento Kin le plantó un beso en la boca a Kiba el cual no supo como reaccionar, si separarse o seguir el ósculo Que tanto le gusto – tranquila – dijo Kiba mientras se separaba de Kin
    - ¿te gustó? – preguntó Kin
    - Algo no besas mal – dijo Kiba
    - ¿quieres salir conmigo? – dijo Kin
    - Que aventada, y la respuesta es no – dijo Kiba
    - ¿Pero te gusto?, ¿Por qué no quieres salir conmigo? – dijo Kin
    - Si pero estoy enamorado de una chica más hermosa que tu y menos zorra, perdón Kin pero las cosas son así y ahora y me voy nos vemos luego – dijo Kiba mientras corría en dirección contraria


    Con Hinata y Kimimaru

    - ¿Te… esta… gustando la escuela? – preguntó Hinata
    - Si, es muy grande y linda – contesto cortes el chico
    - Que…que…bue…bueno – dijo Hinata tartamudeando
    - Tranquila Hina, ¿estas nerviosa? – preguntó Kimimaru
    - ¿Hina?, no estoy nerviosa así hablo, y por favor no me llames Hina, así me dice el chico que me gusta – dijo Hinata
    - Debe ser el chico rubio de ojos azules ¿no? – dijo el joven
    - Pero… ¿Cómo sabes? – dijo Hinata
    - Al entrar al salón tu lo mirabas, yo tengo el don de reconocer quien es flechado, aun que suene cursi, pero es cierto – dijo el muchacho
    - Si es el, se llama Naruto y aunque parece un idiota lo quiero con todo el corazón – dijo Hinata
    - Eso me parece muy tierno de tu parte y que bueno que el amor pueda triunfar – dijo Kimimaru
    - Si, bueno sigamos caminando – dijo Hinata


    Con Shikamaru y Tayuya

    - Que flojera caminar – dijo Shikamaru
    - Pero si ni siquiera nos hemos movido desde que se fueron los demás – dijo Tayuya enojada – lo que pasa es que eres un vago flojeroso
    - Si ya me lo habían dicho – contestó el chico pelo negro – tengo una pregunta ¿todos ustedes, los nuevos, de donde se conocen?
    - … todos venimos de la misma escuela, Sakon y Ukon son hermanos gemelos, Kidomaru y Kin son Hermanastros pero son tan iguales piensan absolutamente lo mismo y son muy aventados, Kimimaru es el mayor reprobó el año pasado y es muy educado y yo soy yo – dijo Tayuya
    - Tengo mala espina de ese Kidomaru y Kin, no me cayeron bien – dijo Shikamaru levantándose de su asiento
    - Y ¿yo te caí bien?- preguntó Tayuya
    - Etto… que problemática situación, mejor vamos a ver que estas haciendo Temari – dijo el chico
    - ¿Quién es Temari? – pregunto la pelirroja
    - Mi novia y la única que me da una razón para vivir esta problemática existencia – dijo el Nara
    - Ok, tiene tu lado sentimental – dijo Tayuya
    - De cierto modo – dijo Shikamaru mientras entraba al salón

    Con Kidomaru y Tenten

    - Sabes que eres muy linda – dijo Kidomaru a Tenten
    - Si, ya me lo habían dicho – dijo Tenten fastidiada por el comentario
    - Y tienes buen cuerpo - decía el joven
    - Ya deja de decirme todo eso me estas poniendo nerviosa – dijo Tenten
    - Lo estoy logrando, eh – dijo kidomaru mientras tomaba a Tenten de la cintura
    - Suéltame y déjame en paz – dijo la castaña
    - ¿y si no quiero? ¿vas a llamar a tus amiguitas para que me golpeen? – dijo Kidomaru riéndose
    - No, si no me dejas voy a llamar a mi novio y te dará una paliza – dijo Tenten
    - Ni siquiera tienes un novio – dijo Kidomaru
    - Claro que tengo novio, déjame y no le diré lo que estas haciendo – dijo Tenten
    - Pues si me va a “golpear” pues que valga la pena ¿no? – dijo Kidomaru
    Kidomaru, tomó a Tenten de la cintura y poco a poco se fue acercando a la boca de la chica, Tenten solo movía sus brazos tratando de quitárselo de encima pero no podía, pasó lo inevitable un pequeño rose de labios
    - Te dije que me soltaras – dijo Tenten mientras derramaba unas pequeñas lagrimas que se derramaban por sus mejillas con un tono carmesí por lo acontecido
    - No me digas que era tu primer beso – dijo kidomaru
    - Cla…claro que no – dijo Tenten nerviosa
    - Espero que tu novio no se enoje, claro si es que existe ¿verdad?- dijo Kidomaru
    - Pues…pues si existe – dijo Tenten enojada cruzando los brazos
    - Yo se que ese era tu primer beso, es más también se que no tienes ningún novio, a ver ¿Cómo se llama?- preguntó Kidomaru
    - Se…se llama… que te interesa, tu no eres nadie para saberlo – dijo Tenten
    - Vez no tienes novio – dijo Kidomaru aún burlándose
    Kidomaru volvió a sostener a Tenten y la tomo por su muñeca apretándola con mucha fuerza provocando que se la lastimara impidiendo un movimiento absoluto
    - Espero que no le digas a nadie de esto, no me gustaría lastimarte o que te pasara algo malo, o ¿si? – dijo Kidomaru con una pregunta retorica – o más fácil por que no aceptas ser mi linda noviecita
    - Claro que no, me lastimaste mi mano y jamás andaría con un tipo como tú eres un idiota – dijo Tenten llorando y yéndose a su salón
    Tenten entró al salón el cual estaba en clase de español o el mismo caso no había maestro por que el profesor Kakashi llega media hora tarde y algunos de sus compañeros le preguntaron si estaba bien puesto que llego deprimida y su muñeca la tenia de un color entre morado y rojo
    - ¿Estás bien? – preguntó Neji hacía Tenten
    - ¿Qué te pasó en la muñeca? – preguntó Ino
    - Nada, estoy bien solo mientras recorría la escuela con Kidomaru me golpee eso es todo, se me quitará mañana - dijo Tenten forzando una sonrisa
    - ¿por que no vas a la enfermería yo te acompaño – dijo Neji
    - No estoy bien – dijo Tenten, pero en ese momento la chica sintió un pequeño dolor en su brazo haciendo un diminuto gemido
    - Ves estas mal, vamos –dijo Neji llevándose a Tenten fuera del salón
    Afuera del salón Neji observó cuidadosamente la herida de su amiga deslizó sus dedos por la muñeca de Tenten la cual hizo un gesto de dolor
    - ¿kidomaru te hizo esto? – preguntó Neji
    - ¿Cómo se dio cuenta, no le puedo decir o si?” – pensó Tenten – Neji te tengo que contar esto, ese chico Kidomaru si me hizo esto
    - ¿por qué?- dijo el Hyuga
    - Me besó a la fuerza y se empezó a burlar de mi, diciendo que era mi primer beso en la boca y muchas tonterías y me dijo que no le dijera a nadie o saldría muy herida – dijo Tenten mirando el suelo mientras con su brazo sano sobaba la muñeca de la otra mano
    - ¡Ese idiota!, me las va a pagar como se le ocurre hacerte esto, aparte de lastimarte te beso es un estúpido – dijo Neji enojado
    - Tranquilo, por favor no le digas a nadie solo… solo fue un beso y ya – dijo Tenten – además no fue el primero – dijo Tenten sonrojada –el primero fue el más hermoso de todos, porque pareció cuento de hada, yo me encontraba dormida y él se acerco a mi pensando que yo descansaba pero lo que no sabia es que yo estaba despierta y me hice la dormida, pude sentir todo ese cariño en ese rose de labios, aunque no se si solo fue un sueño o fue realidad
    - ¿dormida?, ¿estabas despierta cuando te besé… te besaron? – dijo Neji – de seguro fue un sueño
    - Si eso pensé hasta que descubrí que la prima del chico, también estaba despierta y vio todo, no es posible que dos personas tengan el mismo sueño la misma noche y con las mismas personas - dijo Tenten sonriendo
    - …- Neji se evitó comentarios solo se podía observar con un tono aunque estaba disimulado, rojo en las mejillas - ¿Quién era el chico? – dijo Neji
    - ¿quieres que te diga la verdad? – dijo Tenten
    - No, no quiero recordar – dijo Neji – ¿piensas que es un idiota?
    - De cierto modo, me confunde mucho – dijo Tenten desanimada
    - ¿a ti te gusta? – dijo Neji
    - Si a mi me gusta que importa, a ese idiota le gusta una de mis mejores amigas – dijo Tenten con un tono molesto
    - perdóname por no ser lo suficientemente valiente como para hablar contigo de esta situación de frente, ese beso, pensé que estabas dormida, no pensé que Hinata y tú estuvieran viendo, pero ¿por qué no me lo dices de frente si sabes que soy yo quien te besó en la pijamada de mi prima? – pensó Neji


    ************************************************************************
     
    • Me gusta Me gusta x 1
  12.  
    ATANIH

    ATANIH Entusiasta

    Géminis
    Miembro desde:
    12 Mayo 2009
    Mensajes:
    132
    Pluma de
    Re: Vida de un adolescente (varias parejas)

    guau guau guau guaguagaugauaguaggau de verdad muy buen capitulo o mas bien buenos capitulos ya que tenia como 3 dias que no me pasaba por aki jejeje y veo que renuevas todos los dias pones conti nueva que chido de verdad te felicito si son cortas pero muy buenas ademas se puso mas chido tu fic por la trama de los 6 nuevos personajes

    maldito kidomaru como se atreve a hacerle eso a tenten ojala neji lo ponga en su lugar jeje e

    al igual que kin que bueno que kiba le dijo eso pero quein sera esa chica porque bueno Ino ya esta con Sai no es asi

    bueno haber si puedo pasarme mañana o mas bien hoy jejeje ya que ya son las 12am del 26 de enero jejejejee bueno nuevamente te felicito

    casi no tienes faltas de ortografia y sabes redactar bien ademas me alegra que vayas a alargar este fic

    que esta muy bueno jejej

    tambien me alegra que tengas mas lectores qso quisiera que me pasara a mi jejeje pero bueno talves en otro fic que escriba tenga mas lectores jejeje bueno me despido

    sayonara

    tomodashi

    mattane
     
  13.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    1962
    Re: Vida de un adolescente (varias parejas)

    espero que les guste se me acaba la imaginación y el post se repite doble por alguna extraña razón ***************************************************************

    - ¡Ese idiota!, me las va a pagar como se le ocurre hacerte esto, aparte de lastimarte te beso es un estúpido – dijo Neji enojado
    - Tranquilo, por favor no le digas a nadie solo… solo fue un beso y ya – dijo Tenten – además no fue el primero – dijo Tenten sonrojada –el primero fue el más hermoso de todos, porque pareció cuento de hada, yo me encontraba dormida y él se acerco a mi pensando que yo descansaba pero lo que no sabia es que yo estaba despierta y me hice la dormida, pude sentir todo ese cariño en ese rose de labios, aunque no se si solo fue un sueño o fue realidad
    - ¿dormida?, ¿estabas despierta cuando te besé… te besaron? – dijo Neji – de seguro fue un sueño
    - Si eso pensé hasta que descubrí que la prima del chico, también estaba despierta y vio todo, no es posible que dos personas tengan el mismo sueño la misma noche y con las mismas personas - dijo Tenten sonriendo
    - …- Neji se evitó comentarios solo se podía observar con un tono aunque estaba disimulado, rojo en las mejillas - ¿Quién era el chico? – dijo Neji
    - ¿quieres que te diga la verdad? – dijo Tenten
    - No, no quiero recordar – dijo Neji – ¿piensas que es un idiota?
    - De cierto modo, me confunde mucho – dijo Tenten desanimada
    - ¿a ti te gusta? – dijo Neji
    - Si a mi me gusta que importa, a ese idiota le gusta una de mis mejores amigas – dijo Tenten con un tono molesto
    - perdóname por no ser lo suficientemente valiente como para hablar contigo de esta situación de frente, ese beso, pensé que estabas dormida, no pensé que Hinata y tú estuvieran viendo, pero ¿por qué no me lo dices de frente si sabes que soy yo quien te besó en la pijamada de mi prima? – pensó Neji


    Recuerdo:

    Eran las dos de la mañana el la mansión Hyuga, había una pijamada en la habitación de Hinata, una chica de pelo rosa dormía plácidamente en un sillón
    Dos rubias estaban en una colchoneta tirada en el piso dormidas y chica de pelo azul y una castaña reposaban en una cama, las ultimas no podían dormir así que platicaban tratando de no hacer mucho ruido y evitar que se despertaran las otras tres chicas, mientras la luz de la luna iluminaba la habitación:
    - No me puedo dormir Hinata – decía la castaña
    - Yo tampoco, Tenten – respondió Hinata- ¿en que piensas?
    - Pienso… en que cuando estas con Naruto y hay muchas personas a tu alrededor tartamudeas y cuando hablas solo con una persona hablas bien je, je – dijo Tenten mientras reía en silencio
    - Cierto, no se porque me cuesta trabajo hablar bien soy muy tímida – dijo Hinata
    - Si son los nervios, ahora que lo pienso se me olvido pedirle la música de la fiesta a Neji ¿crees que este despierto’ – preguntó Tenten
    - Ya es tarde, pero pienso que si, a de estar pensando en ti – dijo Hinata
    - Ese no es tu estilo Hinata, Sakura, Ino y Temari siempre se burlan de que me guste, pero tú no así que no seas su cómplice – dijo Tenten
    - No es que sea su cómplice, solo que me gusta como se ven juntos, siendo sincera tu eres la única chica con la que Neji se porta cortés y poco ególatra, claro aparte de Hanabi y yo – dijo Hinata
    - Si, pero es tan difícil estar enamorada de alguien como él, es un chico bastante frío, orgulloso y hasta arrogante, antes era un chico fatalista, y solo creía en el destino ha cambiado – dijo Tenten
    - Cierto y fue por una chica, según fue lo que nos comento, pero no se quien era – dijo Hinata
    De repente quedó un silencio entre las dos chicas, el viento azotó la ventana y se oyeron unos pasos por la parte de afuera
    - ¿oíste eso Hinata? – preguntó Tenten
    - Si, a de ser mi padre que esta allá afuera – dijo Hinata

    Los pasos cesaron y se oyó la puerta con un suave movimiento se abrió
    - Viene alguien hasta la dormida – dijo Hinata a Tenten quien acató la orden

    Los pasos se dirigieron por toda la habitación, mientras ésa persona observaba o “creía” que todas estaban dormidas, la persona siguió caminando hasta ponerse a un lado de la cama

    - Hinata ¿esta despierta? – preguntó la voz
    - ¿Que quieres? – decía Hinata que fingía estar dormida
    - Nada vuélvete a dormir – dijo la persona extraña, mientras daba la vuelta al otro lado dela cama donde se encontraba la castaña
    - Tenten ¿estas despierta? – preguntó la voz una vez más
    - … –no dijo nada Tenten que estaba con los ojos cerrados
    - Te traigo la música que vamos a poner en la fiesta acabo de terminar y mañana llegaré un poco tarde a la escuela así que te lo dejo – dijo la persona
    - Neji, gracias por eso te quiero – dijo Tenten mientras se volteaba aun que seguía fingiendo que estaba dormida
    - Tenten sabes algo, te quiero decir esto y es muy importante – dijo Neji
    - …- Tenten no contestó seguía fingiendo y tan buena fue la actuación que Neji se la creyó
    La castaña tenía los ojos cerrados, a simple vista estaba dormida, el chico se fue acercando lentamente a los labios de Tenten, como a un centímetro el chico se dirigió al oído de Tenten y le susurró
    - Yo también te quiero – dijo Neji y subiendo su cara y dándole un delicado ósculo en los labios a Tenten, aunque fue corto fue tan ameno, que Tenten al sentir la boca de Neji en la suya abrió los ojos y sin pensarlo correspondió el beso solo un segundo antes de que se terminara el momento mágico y el chico saliera de la habitación
    Tenten seguía con los ojos cerrados hasta que Hinata las sacudió un poco
    - ¿Qué pasa Hinata?, estaba soñando muy lindo – dijo Tenten tocando sus labios con su mano
    - Pues si el chico que me gusta me besa a la mitad de la noche también estaría soñando cosas bonitas – dijo Hinata
    - A… a ¿Qué te refieres?- preguntó Tenten
    - No te hagas yo los vi, te vi a ti y a mi primo besándose – dijo Hinata con una sonrisa picaresca en el rostro por la felicidad
    - Entonces… ¿entonces no fue un sueño? – dijo Tenten
    - Claro que no, al menos que hayamos tenido el mismo sueño y a la misma hora – dijo Hinata
    - ¿y que voy a hacer ahora? – dijo Tenten
    - Mira como amiga te felicito pero como tu futura prima te digo que no presiones a Neji, de seguro te beso por que estabas dormida, no le hagas comentario de esto no le digas nada, cuando este listo te lo dirá – dijo Hinata
    - ¿entonces ignoro todo lo que acaba de pasar? – preguntó Tenten
    - En pocas palabras, si – dijo Hinata
    - Entonces voy a dormir, por esta noche soy muy feliz – dijo Tenten
    - Pero solo esta noche, recuerda que mañana se te olvidara todo este teatro – dijo Hinata sonriendo- fue una escena tan romántica, el príncipe besando a la princesa como en la bella durmiente – rió Hinata
    - Ja, ja bueno ahora voy a dormir un poco – dijo Tenten
    - Si, buenas noches – dijo Hinata


    Fin del recuerdo.
     
  14.  
    ATANIH

    ATANIH Entusiasta

    Géminis
    Miembro desde:
    12 Mayo 2009
    Mensajes:
    132
    Pluma de
    Re: Vida de un adolescente (varias parejas)

    Guau que gran capitulo enserio te felicito escribes muy bien y me alegra muchisimo que lo sigas haciendo jejejeje enserio no note ninguna falta de ortografia

    guau que lindo recuerdo del sueño enserio me encanto que tonto es neji ya que se decida de una ves y que buenos consejos le dio hinata a tenten ya que por algo conoce a la perdfeccion a su primo jejeje

    que risa con lo de "pues no creo que hayamos tenido el mismo sueño a la misma hora y en el mismo lugar" jejejej que romantico es neji pero solo cuando creen que no lo observa

    bueno esperare con ansias la conti enserio

    sayonara

    eres muy buna redactando

    mattane
     
  15.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    1351
    Re: Vida de un adolescente (varias parejas)

    Fin del recuerdo.


    - Hinata me hizo prometer que no te diría nada, pero ahora sea que no te diré nada porque yo para ti fui una tonta diversión y estoy segura de que me debiste de haber confundido con Sakura ¿no es ella, quien te gusta? –pensó Tenten
    - Bueno, vamos con la directora – dijo Neji
    - ¿a que? – preguntó alterada Tenten
    - No se puede quedar así lo que te hizo, lo deberían de suspender – dijo Neji
    - Claro que no, no se que es lo que pueda hacer – dijo Tenten
    - Bueno entonces vamos con la directora a que te sané tu mano lastimada, ella también tiene un doctorado y vamos – dijo Neji mientras volvía a jalar a Tenten de su mano sana para la dirección

    Entrando a la dirección encontraron ala directora Tsunade platicando con Kiba
    - Kiba ¿Qué haces aquí?- preguntó Tenten
    - Hola, Tenten, Neji ¿Qué hacen aquí? – dijo Kiba
    - Yo pregunté primero – dijo Tenten
    - Bueno me estoy quejando de los chicos nuevos, es que Kin cuando le enseñaba la escuela se me acercó y me besó como sin nada y eso no me gusta y no quiero que se vuelva a repetir con nadie más – dijo Kiba
    - ¿a ti también te besaron a la fuerza igual que Tenten? – dijo Neji
    - ¡¿Qué?! – dijeron Kiba y la directora
    - Neji, me prometiste que no ibas a decir nada de eso, ni lo que me hizo en el brazo, ups ya me eche de cabeza yo solita – dijo Tenten
    - ¿Qué te hizo ese jovencito?, señorita Amma – preguntó Tsunade
    - Nada, solo me besó y me lastimó el brazo, me sujeto demasiado fuerte la muñeca y no puedo moverla, ¿puede ayudarme? – dijo Tenten
    - Si, voy por algo que te quite la hinchazón – dijo Tsunade mientras se retiraba
    - No me caen nada bien esos muchachos – dijo Kiba
    - Ni a mi tampoco, en especial Kidomaru – dijo Neji
    - Si, mira que besar a tu novia – dijo Kiba en resaltando lo ultimo para que cierta chica castaña oyera
    - … - Tenten soltó una pequeña risa, sus mejillas estaban coloradas e ignoró el comentario de Kiba
    - Ja, que gracioso – dijo Neji sarcástico – si además nadie besa a mi novia sin mi autorización
    - A ver Neji ¿desde cuando tienes un lado bromista? – dijo Tenten riéndose – ya dejen de estar diciendo tonterías
    - Yo, tengo un lado bromista desde que le dijiste a Lee muchas cosas el sábado en el video Messenger – dijo Neji
    - Pues ni siquiera le dije nada, solo que te habías cuidado je – dijo Tenten riendo – además se lo merecía ¿no? Y tu también por decir que no estas con una chica – dijo Tenten
    - Si, no quiero saber de que se cuido Neji así que me voy, me iré a buscar a Ino, para invitarle un… Tenten tú que eres amiga de Ino ¿cual es su bebida favorita? – preguntó Kiba
    - Jugo de Naranja, pero va a ir con su novio después de clase a hacer un proyecto así que no creo que este disponible – dijo Tenten
    - ¡¿Qué?! – dijo Kiba exaltado – pero ¿Cómo? ¿Quién? ¿tiene novio?
    - Desde el sábado Ino sale con Sai – dijo Neji
    - ¿Cómo sabes? – dijo Tenten – ahora que me acuerdo de seguro oyeron nuestra platica cuando Naruto y tú espiaban atrás de la puerta – dijo Tenten enojada
    - Neji, ¿Cómo caíste tan bajo al grado de espiar atrás de las puertas como Naruto? – dijo Kiba riéndose
    - Fue un accidente – dijo Neji apenado
    - Pues me entristece lo de Ino, pero si ella es feliz, yo también de vería de serlo, ya encontraré a alguien que me quiera como soy y que yo la ame con todo el corazón – dijo Kiba
    - Ya encontrarás a alguien – dijo Tenten sonriendo dando esperanzas a algo que tal vez en un futuro lejano pasará
    - Gracias – dijo Kiba mientras se retiraba de la dirección – Neji al rato nos vemos en casa de Shikamaru
    - Así, y lo de la banda ¿si se va a hacer? – preguntó Neji
    - ¿Cuál banda? - preguntó Tenten
    - A bueno una banda, para lo de la fiesta de Halloween, van a cantar y a tocar instrumentos, si quieres puedes inscribir a la tuya – dijo Kiba
    - Si lo voy a hacer – dijo Tenten
    - Pero lastima que vayan a perder, por los “Shinobis” vamos a ganar - dijo Kiba
    - ¿Shinobis Así se llaman? – preguntó Tenten
    - Si, bueno al rato nos vemos Neji, que te mejores Tenten – dijo Kiba saliendo de la dirección con mucha prisa
    - Aquí traigo algo para ayudarte – dijo Tsunade – me encargaré de esos chicos al rato – decía la directora mientras curaba la muñeca de Tenten y le ponía una venda – lo mejor es que no muevas tu mano para nada
    - Si, directora – dijo Tenten – muchas gracias
    - De nada, ya váyanse a su salón los dos – dijo Tsunade
    - Si – dijeron ambos
     
    • Me gusta Me gusta x 1
  16.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    613
    Re: Vida de un adolescente (varias parejas)

    capitulo cortito porque no me comentaron en el anterior






    Al llegar al salón, los del grupo “a” ya se habían incorporado al salón junto con los chicos de intercambio era la materia de Artes y como la maestra Kurenai estaba embarazada no había maestro, los chicos entraron al salón que se sentía más lleno por los compañeros nuevos, Tenten se fue con sus amigas y Neji se fue con sus amigos, pero vamos con la chicas:

    - ¿Cómo sigues? - preguntó Ino a Tenten quien se acercaba
    - Bien, la directora me puso algo y ya estoy mejor – dijo Tenten
    - ¿Qué te pasó? – preguntaron las chicas
    - Nada solo me golpee por torpe – dijo Tenten – y que creen tengo una súper noticia
    - ¿Cuál? – dijo Hinata
    - Pues hay que hacer una banda – dijo Tenten
    - Si y con la banda podremos entrar al concurso el día de la fiesta – dijo Ino
    - A, ya sabias yo les quiera decir – dijo Tenten algo triste porque arruinaron su sorpresa
    - No importa, entonces hay que hacer una banda – dijo Ino
    - Yo toco el teclado – dijo Temari
    - Yo toco la guitarra eléctrica - dijo Tenten
    - Yo canto – dijo Sakura
    - Ok, entonces yo las represento ¿Qué les parece chicas? – dijo Ino
    - Esta bien, pero ¿yo que voy a hacer? – dijo Hinata
    - Tu puedes tocar el pandero Hinata- dijo Temari
    - Ok, y ¿Cómo nos vamos a llamar? – preguntó Hinata
    - Que les parece las chicas de Konoha – dijo Sakura
    - No – dijeron las jóvenes
    - Las 4 fantásticas de Ino – dijo la rubia de ojos azules
    - No Ino, jamás nos llamaríamos así – dijeron las chicas al unísono
    - Los chicos se iban a llamar “Shinobis” que significa ninja, ¿Por qué no nos llamamos Kunoichis? Significa ninjas mujeres – dijo Tenten
    - Suena bien, será divertido, bueno empezamos los ensayos mañana en mi casa – dijo Ino
    - Ok, solo deja que mi brazo se recuperé ¿si? – dijo Tenten
    - Ok – respondieron las demás
     
    • Me gusta Me gusta x 1
  17.  
    sakurakushku

    sakurakushku Entusiasta

    Acuario
    Miembro desde:
    18 Abril 2009
    Mensajes:
    87
    Pluma de
    Escritor
    Re: Vida de un adolescente (varias parejas)

    holaa!
    super aran una banda ^^ qe emocion
    ajaj me imjino a hinata tocando el pandero ! jaja
    i ahí a sakura cantando i temari en el teclado i tenten
    con la guitarra, pobre tenten , lo qe le iso ese estupido!
    bueno siguelo, esta super buena! ia quiero saber como van a tocar!
    bueno saludos by-bye!!
    ATTE: Katee!!
     
  18.  
    mickis

    mickis Iniciado

    Libra
    Miembro desde:
    9 Abril 2009
    Mensajes:
    44
    Pluma de
    Escritora
    Re: Vida de un adolescente (varias parejas)

    hola amiga recibi la invitacion y m,e pase a leer lo q pude..
    realmente me encanto aunq no pude terminarlo jeje xD...
    el shikatema de siempre ( tipico de las parejas de naruto) me parece bn q ino salga pero cn sai??? ese chico es medio raro (para mí) y ¿cuando s le dio naruto espiar a otras chicas? es un pervertido ( jeje igual que su viejo maestro jiraiya) y me encanta la nueva personalidad de hinatat aunque la preferia tímida oalgo así jeje,...
    pero lo q debo decir es me me encantó muchísimo tu fic
    continualo pronto!
     
  19.  
    jenn uchiha

    jenn uchiha Entusiasta

    Capricornio
    Miembro desde:
    3 Noviembre 2009
    Mensajes:
    162
    Re: Vida de un adolescente (varias parejas)

    KOonnIchiwAaa ... ;)
    muxoo sin pasar ya asta me habia atrazad0o en 3 capis .:omg:.
    bueno que onda con esos chicos nuevos ,,..que se creen llegar && asi comoo
    si nada bajar alas novias && novios ... me enojare !!
    hhaaaii ke cool van a formar una banda superr
    porfavor continuala ...
    quiero saber que ba aser Neji al respecth0o && los demas nuevos
    sakura andara con el nuevo o n0o ..
    buen0o continuala pliiisss ssiisiiis..
    buen0o biieee ..ttcuidas muxxo..tQm
     
  20.  
    DawnPanIno

    DawnPanIno Recordad que el yaoi es lo máximo.

    Leo
    Miembro desde:
    12 Octubre 2009
    Mensajes:
    149
    Pluma de
    Escritora
    Título:
    Vida de un adolescente (varias parejas)
    Total de capítulos:
    77
     
    Palabras:
    798
    Re: Vida de un adolescente (varias parejas)

    Las chavas ya crearon su grupo, Las Kunoichis, pero ¿Quién ganará la competencia de bandas ¿Kunoichis o Shinobis?.
    La clase terminó y Tsunade fue a ver ese salón, mando llamar a Kin y a Kidomaru, se los llevo a su oficina, estuvieron ahí durante un buen rato, hasta que sonó el timbre de la siguiente clase, el profesor que impartía su materia se retiró y llegó otro junto con los dos muchachos que se había llevado la directora, haciendo un gesto de desagrado a Kiba y a Tenten respectivamente por haberos echado de cabeza, la clase fue en cierto modo muy rápida puesto que era la ultima y duraba menos, sonó el timbre de salida y los jóvenes abandonaron su salón de cátedra y a la salida de la escuela

    - Bueno nos vemos mañana – se despedían Sakura y Temari las cuales se retiraban despidiéndose de sus amigas

    Sai buscó a Ino y se la llevó para que hicieran un proyecto, algunos chavos se iban a la casa de Shikamaru, excepto uno, que se acercó a donde estaban Tenten y Hinata hablando

    - Hola, ¿Cómo sigue tú mano? – dijo Neji a Tenten
    - A bien, bueno yo ya me voy, me voy a mi casa, luego nos vemos - se despidió Tenten de los Hyuga
    - Espera, déjame ayudarte con tu mochila, tengo que hablar contigo sobre lo de… bueno ¿puedo acompañarte a tu casa? – preguntó Neji a Tenten
    - Este…- dijo Tenten viendo a Hinata
    - A si, yo le aviso a mi padre que llegaras más tarde primo – dijo Hinata
    - No hay problema yo de aquí tengo que ir a la casa de Shikamaru así que no voy a llegar temprano
    - Esta bien, yo ya me voy – dijo Hinata mientras caminaba descuidadamente y chocó con alguien
    - Hola – saludó La voz
    - A, lo siento por el golpe Kimimaru – dijo Hinata
    - ¿vas a tu casa? – preguntó el chico
    - Si – dijo Hinata
    - Te acompaño, claro si tu quieres – dijo Kimimaru
    - ¡Hinata! – gritó un rubio hiperactivo
    - Na… Naruto ¿Qué pasa? – preguntó Hinata
    - Ya te vas, pensé que te quedarías un poco más pero veo que tienes compañía – dijo Naruto viendo de una manera de rivalidad a Kimimaru – solo quería saber si tu padre no te regaño el sábado después de que fuimos a cenar
    - A no te preocupes por eso, solo que mi primo me tendrá que acompañar a todos los lugares que vaya cuando este a solas con algún chico je, je – rio Hinata
    - Y ¿en donde esta Neji?, estas sola con Kimimaru ¿no debería de estar por aquí? – dijo Naruto de una manera un poco grosera a Kimimaru
    - Este… él se fue con una amiga y después va a ir a la casa de Shikamaru – dijo Hinata
    - A cierto se me había olvidado la reunión – dijo Naruto cubriendo con su mano su cabeza – ya me voy nos vemos mañana en la escuela – Kimimaru espero que cuides a Hina muy bien o sino jamás te lo perdonaré
    - Si – dijo Kimimaru extrañado
    - Bueno adiós – dijo el rubio corriendo en dirección a la casa del Nara
     
    • Me gusta Me gusta x 1
Estado del tema:
No se permiten más respuestas.

Comparte esta página

  1. This site uses cookies to help personalise content, tailor your experience and to keep you logged in if you register.
    By continuing to use this site, you are consenting to our use of cookies.
    Descartar aviso